Sökresultat

Integrating Rights and Equality in Climate Change, Disasters, and Human Mobility: A Primer for Higher Education Institutions Integrating Rights and Equality in Climate Change, Disasters, and Human Mobility: A Primer for Higher Education Institutions Prepared by Graduate Legal Studies Institute, Ateneo de Manila University School of Law, for the Raoul Wallenberg Institute of Human Rights and Humani

https://rwi.lu.se/wp-content/uploads/2025/06/FINAL-20250207_Integrating-Rights-and-Equality_FA.pdf - 2026-05-19

kemikalier – Vetenskap och Hälsa Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Etikett: kemikalier Hur påverkar miljön vår hälsa? 2019-10-28 Genrebild: Dreamstime Lars Rylander installerades som professor i arbets- och miljömedicin den 18 oktober 2019 vid Lunds universitet. Nedan skriver han själv om sin fors

https://www.vetenskaphalsa.se/tag/kemikalier/ - 2026-05-19

Psykisk (o)hälsa – Sida 5 – Vetenskap och Hälsa Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Kategori: Psykisk (o)hälsa Ångest driver vittnen att ingripa vid mobbning 2021-06-09 Hundratusentals skolelever kommer dagligen i kontakt med mobbning – som offer, mobbare eller vittnen. Man vet att omgivningens reak

https://www.vetenskaphalsa.se/kategori/psykiska-ohalsa/page/5/ - 2026-05-18

Director of Doctoral studies, Department of Economics, Professor Contact details Email: erik [dot] wengstrom [at] nek [dot] lu [dot] se Phone: +46 46 222 01 23Organisation Department of Economics Room number: Alfa1:4091A Service point: 10 WebpageErik Wengströms profile in Lund University research portalPersonal website:https://sites.google.com/site/erikwengstromOther affiliations Member of Strateg

https://www.lusem.lu.se/erik-wengstrom - 2026-05-18

First meeting of the Advisory Board! First meeting of the Advisory Board! Published 29 September 2025 First Advisory Board meeting as a Lund University Core Facility today! Today was the first (of many!) meetings with the newly established Advisory Board for the Humanities Lab. We are so happy to have a chance to talk, discuss and pick the brains of so many brilliant people! The LU Humanities Lab

https://www.humlab.lu.se/article/first-meeting-of-the-advisory-board/ - 2026-05-18

Background: Endoscopic resection of T1 colon cancer (CC) is currently limited by guidelines related to risk of lymph node metastases. However, clinical outcome following endoscopic and surgical resection is poorly investigated. Method: A retrospective multicentre national cohort study was conducted on prospectively collected data from the Swedish colorectal cancer registry on all non-pedunculated

Background: Women with adverse pregnancy outcomes may have higher subsequent risk of chronic kidney disease, but the long-term independent risks and potential causality are unclear. Objective: This study aimed to determine long-term risks of chronic kidney disease associated with 5 major adverse pregnancy outcomes in a large population-based cohort, and to assess for familial confounding using co-

BACKGROUND: Hormone receptor positivity predicts benefit from endocrine therapy but the knowledge about the long-term survival of patients with different tumor receptor levels is limited. In this study, we describe the 25 years outcome of tamoxifen (TAM) treated patients.PATIENTS AND METHODS: Between 1983 and 1992, a total of 4,610 postmenopausal patients with early-stage breast cancer were random

Tree roots and their fungal symbionts mediate the response of rhizosphere soil organic carbon (SOC) decomposition to climate warming, specifically the temperature sensitivity of soil microbial respiration (Q10), which is a critical parameter for projecting the magnitude of terrestrial soil C-climate feedbacks. However, the intensity of the rhizosphere effects (RE; rhizosphere soils vs. bulk soils)

Objectives. Nearly half of men with clinically localized prostate cancer are understaged. We evaluated whether knowledge of preoperative free prostate-specific antigen (f-PSA), complexed (c-PSA), and total (t-PSA) concentrations or the ratios thereof (f-PSA/t-PSA, c-PSA/t PSA, and f PSA/c- PSA) could improve upon the staging of prostate cancer when compared with standard PSA testing (t-PSA). In ad

Background: Pressure–volume (PV) loops provide comprehensive information of cardiac function, but commonly implies an invasive procedure under general anesthesia. A novel technique has made it possible to non-invasively estimate PV loops with cardiac magnetic resonance (CMR) and brachial pressure which would enable good volume estimation of often anatomically complex ventricles without the need of

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Purpose: Fluoropyrimidine plus platinum (FP) is currently the standard treatment for esophageal cancer (EC). In recent years, taxane-based chemotherapy has also been used and has shown good efficacy in EC. This study aims to investigate the advantages of taxane-based over FP chemotherapy, as well as discuss its drawbacks, in the treatment of EC. Patients and methods: A literature search was done f

Cryptosystems based on the learning with errors (LWE) problem are assigned a security level that relates to the cost of generic algorithms for solving the LWE problem. This includes at least the so-called primal and dual lattice attacks. In this paper, we present an improvement of the dual lattice attack using an idea that can be traced back to work by Bleichenbacher. We present an improved distin

Background: Celiac disease often goes undiagnosed. Mass screening might be an option to reduce the public health burden of untreated celiac disease. However, mass screening is still controversial since it is uncertain whether the benefits of early detection outweigh the possible negative consequences. Before implementation of screening programs, the experiences of those being identified as cases s

Allt fler personer reser allt längre sträckor för att ta sig till och från jobbet. En starkt bidragande orsak till detta är en strävan att öka den ekonomiska tillväxten genom att göra arbetskraften tillgänglig över allt större geografiska områden. I Sverige har både pendlingstid och avstånd stadigt ökat under de senaste decennierna och idag tillbringar den genomsnittliga pendlaren mer än en timme Allt fler personer reser allt längre sträckor för att ta sig till och från jobbet. En starkt bidragande orsak till detta är en strävan att öka den ekonomiska tillväxten genom att göra arbetskraften tillgänglig över allt större geografiska områden. I Sverige har både pendlingstid och avstånd stadigt ökat under de senaste decennierna och idag tillbringar den genomsnittliga pendlaren mer än en timme

Popular Abstract in Swedish Hypertriglyceridemi (förhöjd plasma triglycerid(TG)nivå) är en riskfaktor för hjärt- kärlsjukdom. Det har föreslagits att relationen mellan fettintag och arterioskleros orsakas av vad som utspelar sig timmarna efter måltid. TG i chylomikronerna (CM) , dvs de fettrika partiklar som transporterar kostens fett via lymfan till blodbanan hydrolyseras då av lipoproteinlipas, 1. During incubation of platelets with 3H-arachidonic acid (20:4, n-6) and 14C-cholesterol doubly labelled and colloidal gold labelled chylomicrons (CMs) and chylomicron remnants (CMRs) CMs were taken up more efficiently than CMRs. Addition of unlabelled CMs, VLDLs, LDLs and HDLs decreased the uptake of labelled CMs. Electron microscopic studies demonstrated an accumulation of CM-Au's both in the

Cloud condensation nuclei counter (CCNC) measurements performed at 14 locations around the world within the European Integrated project on Aerosol Cloud Climate and Air Quality interactions (EUCAARI) framework have been analysed and discussed with respect to the cloud condensation nuclei (CCN) activation and hygroscopic properties of the atmospheric aerosol. The annual mean ratio of activated clou

Adsorption of uncharged homopolymers of various flexibilities in good solvent onto planar surfaces Lit various polymer-surface interaction strengths have been investigated by employing a coarse-grained bead-spring polymer model using simulation techniques. The polymer flexibility ranged from fully flexible to rod-like polymers, and the adsorption strength varied from weak to strong adsorption. Equ

Popular Abstract in English News about global warming, discussions about alternative fuels such as natural-gas and biogas, and commercials about gas engines sound familiar to the most people living in modern societies. Why global warming is important? What is the role of natural-gas engines in this subject? Are natural-gas engines efficient? Do they perform as well as diesel engines? If not, why? Most heavy-duty engines are diesel operated. Severe emission regulations, high fuel prices, high technology costs (e.g. catalysts, fuel injection systems) and unsustainably in supplying fuel are enough reasons to convenience engine developers to explore alternative technologies or fuels. Using natural gas/biogas can be a very good alternative due to the attractive fuel properties regarding emissio