Filtyp
Background: Pressure–volume (PV) loops provide comprehensive information of cardiac function, but commonly implies an invasive procedure under general anesthesia. A novel technique has made it possible to non-invasively estimate PV loops with cardiac magnetic resonance (CMR) and brachial pressure which would enable good volume estimation of often anatomically complex ventricles without the need of
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
Purpose: Fluoropyrimidine plus platinum (FP) is currently the standard treatment for esophageal cancer (EC). In recent years, taxane-based chemotherapy has also been used and has shown good efficacy in EC. This study aims to investigate the advantages of taxane-based over FP chemotherapy, as well as discuss its drawbacks, in the treatment of EC. Patients and methods: A literature search was done f
Cryptosystems based on the learning with errors (LWE) problem are assigned a security level that relates to the cost of generic algorithms for solving the LWE problem. This includes at least the so-called primal and dual lattice attacks. In this paper, we present an improvement of the dual lattice attack using an idea that can be traced back to work by Bleichenbacher. We present an improved distin
Background: Celiac disease often goes undiagnosed. Mass screening might be an option to reduce the public health burden of untreated celiac disease. However, mass screening is still controversial since it is uncertain whether the benefits of early detection outweigh the possible negative consequences. Before implementation of screening programs, the experiences of those being identified as cases s
Allt fler personer reser allt längre sträckor för att ta sig till och från jobbet. En starkt bidragande orsak till detta är en strävan att öka den ekonomiska tillväxten genom att göra arbetskraften tillgänglig över allt större geografiska områden. I Sverige har både pendlingstid och avstånd stadigt ökat under de senaste decennierna och idag tillbringar den genomsnittliga pendlaren mer än en timme Allt fler personer reser allt längre sträckor för att ta sig till och från jobbet. En starkt bidragande orsak till detta är en strävan att öka den ekonomiska tillväxten genom att göra arbetskraften tillgänglig över allt större geografiska områden. I Sverige har både pendlingstid och avstånd stadigt ökat under de senaste decennierna och idag tillbringar den genomsnittliga pendlaren mer än en timme
Popular Abstract in Swedish Hypertriglyceridemi (förhöjd plasma triglycerid(TG)nivå) är en riskfaktor för hjärt- kärlsjukdom. Det har föreslagits att relationen mellan fettintag och arterioskleros orsakas av vad som utspelar sig timmarna efter måltid. TG i chylomikronerna (CM) , dvs de fettrika partiklar som transporterar kostens fett via lymfan till blodbanan hydrolyseras då av lipoproteinlipas, 1. During incubation of platelets with 3H-arachidonic acid (20:4, n-6) and 14C-cholesterol doubly labelled and colloidal gold labelled chylomicrons (CMs) and chylomicron remnants (CMRs) CMs were taken up more efficiently than CMRs. Addition of unlabelled CMs, VLDLs, LDLs and HDLs decreased the uptake of labelled CMs. Electron microscopic studies demonstrated an accumulation of CM-Au's both in the
Cloud condensation nuclei counter (CCNC) measurements performed at 14 locations around the world within the European Integrated project on Aerosol Cloud Climate and Air Quality interactions (EUCAARI) framework have been analysed and discussed with respect to the cloud condensation nuclei (CCN) activation and hygroscopic properties of the atmospheric aerosol. The annual mean ratio of activated clou
Adsorption of uncharged homopolymers of various flexibilities in good solvent onto planar surfaces Lit various polymer-surface interaction strengths have been investigated by employing a coarse-grained bead-spring polymer model using simulation techniques. The polymer flexibility ranged from fully flexible to rod-like polymers, and the adsorption strength varied from weak to strong adsorption. Equ
Popular Abstract in English News about global warming, discussions about alternative fuels such as natural-gas and biogas, and commercials about gas engines sound familiar to the most people living in modern societies. Why global warming is important? What is the role of natural-gas engines in this subject? Are natural-gas engines efficient? Do they perform as well as diesel engines? If not, why? Most heavy-duty engines are diesel operated. Severe emission regulations, high fuel prices, high technology costs (e.g. catalysts, fuel injection systems) and unsustainably in supplying fuel are enough reasons to convenience engine developers to explore alternative technologies or fuels. Using natural gas/biogas can be a very good alternative due to the attractive fuel properties regarding emissio
Transforming growth factor-beta (TGF-β) is a pleiotropic cytokine with the capability to act as tumour suppressor or tumour promoter depending on the cellular context. TGF-beta receptor type-2 (TGFBR2) is the ligand-binding receptor for all members of the TGF-β family. Data from mouse model experiments demonstrated that loss of Tgfbr2 expression in mammary fibroblasts was linked to tumour initiati
Aim: To develop a logistic regression model for discrimination between benign and malignant unilocular solid cysts with papillary projections but no other solid components, and to compare its diagnostic performance with that of subjective evaluation of ultrasound findings (subjective assessment), CA 125 and the risk of malignancy index (RMI). Methods: Among the 3511 adnexal masses in the Interna
The aim of this study was to develop an in-vitro release method suitable for injectable slow-release lipid formulations of local anaesthetics (or other drugs). We also aimed that the results of the in-vitro measurements should have a clear relationship to duration of action in-vivo. Six formulations of bupivacaine base in medium-chain triglyceride-glyceryl dilaurate mixtures were developed. A new
S-phase fraction (SPF), estimated in the flow cytometric DNA histogram, is a prognostic factor in breast cancer. There are, however, some inherent difficulties in the estimation of SPF, such as the influence of debris, aggregates, and normal cells. Most of the available SPF calculation principles try to consider these difficulties, but so far no consensus has been reached with regard to which prin
BACKGROUND: High concentrations of lithium in drinking water were previously discovered in the Argentinean Andes Mountains. Lithium is used worldwide for treatment of bipolar disorder and treatment-resistant depression. One known side effect is altered thyroid function. OBJECTIVES: We assessed associations between exposure to lithium from drinking water and other environmental sources and thyroid
Background: Malignant melanoma is the most lethal form of skin cancer with a variable clinical course even in patients with thin melanomas and localized disease. Despite increasing insights into melanoma biology, no prognostic biomarkers have yet been incorporated into clinical protocols. Reduced expression of the RNA binding motif protein 3 (RBM3) has been shown to correlate with tumour progressi
Popular Abstract in Swedish Vid total höftledsartroplastik är cementering av den konstgjorda ledpannan (cupen) ett allmänt sett välfungerande koncept, men frekvensen av lossning och åtföljande omoperation är fortfarande för hög. En av de viktigaste faktorerna för långtidsöverlevnad av protesimplantat är den initialt uppnådda fixationen och stabiliteten. Den föreliggande avhandlingen omfattar såvälIn total hip arthroplasty cemented fixation of the acetabular component is a generally successful concept, but the rate of aseptic loosening and consequent revision surgery is still too high. One of the crucial factors for longterm implant survival is the initial fixation and stability. This thesis comprises experimental and clinical studies, including radiostereometry (RSA) with up to 5 years fol
Infectious pancreatic necrosis virus (IPNV) is a naked virus of an uncomplicated structure. In the interior part of the virion, the two segments of double-stranded RNA are located together with the minor structural protein VP1. This protein is detected in its free form as well as linked to the genome. A polymerase activity has been assigned for VP1. The localisation of the viral protein VP3 has a
Objective: The minor G allele of FOXO3A rs2802292 has been associated with longevity. We aimed to investigate whether a phenotype related to healthy metabolic aging could be identified in individuals carrying the longevity-associated FOXO3A rs2802292 G allele. Research Design and Methods: rs2802292 was genotyped in a phenotypically well-characterized population of young and elderly twins (n = 190)
A Holocene sediment sequence from Lake Igelsjon, south central Sweden, was studied by stable oxygen- and carbon-isotope analyses of different carbonate components. The deposit, which covers the time-span from ca 11,500 cal BP to the present, was laid down in a small, kettle-hole lake, the hydrological balance of which is presently dominated by groundwater flow. Isotopic records obtained on bulk ca
