Sökresultat

Så har Nobelpriset omformat litteraturvärlden – ny forskning Så har Nobelpriset omformat litteraturvärlden – ny forskning Av Gisela Lindberg - Publicerad den 3 oktober 2023 2022 års Nobelpristagare i litteratur Annie Ernaux tar emot Nobelpriset ur Kung Carl XVI Gustafs hand på Konserthuset i Stockholm. © Nobel Prize Outreach. Photo: Nanaka Adachi Just nu surras det bland bokintresserade och intell

https://www.sol.lu.se/article/nobelpriset-har-foeraendrat-det-litteraera-samtalet/ - 2026-05-18

Programme European Film Cultures ECREA Film Studies Section Interim Conference 8-9 November 2013, Centre for Languages and Literature, Lund University, Sweden – PROGRAMME – ELISABETH RAUSINGS MINNESFOND EUROPEAN FILM CULTURES – LUND, 8–9 NOVEMBER 2013 2 ECREA – European Communication Research and Education Association ECREA is the learned society for communication scholars across Europe and beyond

https://konferens.ht.lu.se/fileadmin/_migrated/content_uploads/Ecrea_Programme__last_updated_5_November.pdf - 2026-05-18

teologdagar 97 Ur programmet: 6 november ÄR GUD TÄNKBAR? Föreläsning av professorn och författaren LARS GUSTASSON, Austin, Texas PANELSAMTAL med prof Lars Gustafsson, bitr prof Sten Hidal, Kulturredaktör Maria Schottenius, Expressen, prof Tord Olsson, prof Göran Bexell (debattledare) över temat ÄR GUD TÄNKBAR - exemplet svensk kultur- och samhällsdebatt inför 2000-talet 7 och 8 november ÖPPET HUS

https://www.ctr.lu.se/fileadmin/user_upload/ctr/pdf/ctrdagar/teoldag97.pdf - 2026-05-18

Professor Kontaktinformation E-post: mats [dot] olsson [at] ekh [dot] lu [dot] se Telefon: +46 46 222 31 18 Mobil: +46 72 524 01 79Organisation Ekonomisk-historiska institutionen Besöksadress: Scheelevägen 15B, Alfa 1, Lund Rumsnummer: Alfa1:2070 Hämtställe: 10 WebbplatsMats Olssons profil i Lunds universitets forskningsportalAndra roller Professor Tillväxt, teknologisk förändring och ojämlikhet P

https://www.ehl.lu.se/mats-olsson - 2026-05-18

Microsoft Word - JannaschKarlssonNilsson_Proceedings.doc Referat — Målsättningen med detta projekt var att utveckla ett praktiskt och resurssnålt pedagogiskt instrument för att öka den kontinuerliga återkopplingen och studentaktiveringen i stora föreläsningskurser. Ett interaktivt diagnostiskt prov utvecklades, och implementerades sedan i LTH-kursen Miljökemi med 88 studenter. Det anonyma flervals

https://www.lth.se/fileadmin/lth/genombrottet/konferens2008/P_Jannasch__E_Nordberg_Karlsson__U_Nilsson.pdf - 2026-05-19

Hopp om ny metod för att lindra svår epilepsi – Vetenskap och Hälsa Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Hopp om ny metod för att lindra svår epilepsi 2018-04-06 ⚠️ Den här artikeln är mer än 5 år gammal. Nya forskningsrön kan ha tillkommit. Forskare vid Lunds universitet tror sig ha hittat en metod

https://www.vetenskaphalsa.se/hopp-om-ny-metod-for-att-lindra-svar-epilepsi/ - 2026-05-19

Integrating Rights and Equality in Climate Change, Disasters, and Human Mobility: A Primer for Higher Education Institutions Integrating Rights and Equality in Climate Change, Disasters, and Human Mobility: A Primer for Higher Education Institutions Prepared by Graduate Legal Studies Institute, Ateneo de Manila University School of Law, for the Raoul Wallenberg Institute of Human Rights and Humani

https://rwi.lu.se/wp-content/uploads/2025/06/FINAL-20250207_Integrating-Rights-and-Equality_FA.pdf - 2026-05-19

kemikalier – Vetenskap och Hälsa Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Etikett: kemikalier Hur påverkar miljön vår hälsa? 2019-10-28 Genrebild: Dreamstime Lars Rylander installerades som professor i arbets- och miljömedicin den 18 oktober 2019 vid Lunds universitet. Nedan skriver han själv om sin fors

https://www.vetenskaphalsa.se/tag/kemikalier/ - 2026-05-19

Professor Contact details Email: marina [dot] svensson [at] ace [dot] lu [dot] se Phone: +46 46 222 40 68Organisation Centre for East and South-East Asian Studies, Lund University Visiting address: Sölvegatan 18B, Lund Room number: 126 Service point: 61 WebpageMarina Svenssons profile in Lund University research portalOther affiliations Profile area member LU Profile Area: Human rightsI studied Ch

https://www.ace.lu.se/marina-svensson - 2026-05-18

Professor of Fine Arts Contact details Email: joachim [dot] koester [at] khm [dot] lu [dot] seOrganisation Malmö Art Academy WebpageJoachim Koesters profile in Lund University research portalJoachim Koester is a Danish artist based in Copenhagen.  His work has been shown at documenta X, Kassel; 2nd Johannesburg Biennale; Gwangju Biennale 1995; 54th Venice Biennale; Busan Biennale 2006; Manifesta 7

https://www.khm.lu.se/en/joachim-koester - 2026-05-18

Docent Kontaktinformation E-post: ulrika [dot] holgersson [at] hist [dot] lu [dot] seOrganisation Historia Hämtställe: 30 WebbplatsUlrika Holgerssons profil i Lunds universitets forskningsportalAndra roller Studierektor för forskarutbildningen Forskarskolan i historia Universitetslektor Historia Studierektor för forskarutbildningen HistoriaI min forskning använder jag olika medier, exempelvis veck

https://www.journalistik.lu.se/ulrika-holgersson - 2026-05-18

Psykisk (o)hälsa – Sida 5 – Vetenskap och Hälsa Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Kategori: Psykisk (o)hälsa Ångest driver vittnen att ingripa vid mobbning 2021-06-09 Hundratusentals skolelever kommer dagligen i kontakt med mobbning – som offer, mobbare eller vittnen. Man vet att omgivningens reak

https://www.vetenskaphalsa.se/kategori/psykiska-ohalsa/page/5/ - 2026-05-18

First meeting of the Advisory Board! First meeting of the Advisory Board! Published 29 September 2025 First Advisory Board meeting as a Lund University Core Facility today! Today was the first (of many!) meetings with the newly established Advisory Board for the Humanities Lab. We are so happy to have a chance to talk, discuss and pick the brains of so many brilliant people! The LU Humanities Lab

https://www.humlab.lu.se/article/first-meeting-of-the-advisory-board/ - 2026-05-18

Background: Endoscopic resection of T1 colon cancer (CC) is currently limited by guidelines related to risk of lymph node metastases. However, clinical outcome following endoscopic and surgical resection is poorly investigated. Method: A retrospective multicentre national cohort study was conducted on prospectively collected data from the Swedish colorectal cancer registry on all non-pedunculated

Background: Women with adverse pregnancy outcomes may have higher subsequent risk of chronic kidney disease, but the long-term independent risks and potential causality are unclear. Objective: This study aimed to determine long-term risks of chronic kidney disease associated with 5 major adverse pregnancy outcomes in a large population-based cohort, and to assess for familial confounding using co-

BACKGROUND: Hormone receptor positivity predicts benefit from endocrine therapy but the knowledge about the long-term survival of patients with different tumor receptor levels is limited. In this study, we describe the 25 years outcome of tamoxifen (TAM) treated patients.PATIENTS AND METHODS: Between 1983 and 1992, a total of 4,610 postmenopausal patients with early-stage breast cancer were random

Tree roots and their fungal symbionts mediate the response of rhizosphere soil organic carbon (SOC) decomposition to climate warming, specifically the temperature sensitivity of soil microbial respiration (Q10), which is a critical parameter for projecting the magnitude of terrestrial soil C-climate feedbacks. However, the intensity of the rhizosphere effects (RE; rhizosphere soils vs. bulk soils)

Objectives. Nearly half of men with clinically localized prostate cancer are understaged. We evaluated whether knowledge of preoperative free prostate-specific antigen (f-PSA), complexed (c-PSA), and total (t-PSA) concentrations or the ratios thereof (f-PSA/t-PSA, c-PSA/t PSA, and f PSA/c- PSA) could improve upon the staging of prostate cancer when compared with standard PSA testing (t-PSA). In ad

Background: Pressure–volume (PV) loops provide comprehensive information of cardiac function, but commonly implies an invasive procedure under general anesthesia. A novel technique has made it possible to non-invasively estimate PV loops with cardiac magnetic resonance (CMR) and brachial pressure which would enable good volume estimation of often anatomically complex ventricles without the need of

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti