Filtyp
This thesis deals with Chiral Perturbation Theory (ChPT), an effective field theory for the strong force used to describe meson interactions. The work done can be split in two parts. The first one is on ChPT in its standard formulation. This theory has been very successful so far in describing low energetic processes. However, it is still not entirely clear how much it can be trusted for precision
Most types of materials and components use heating during the manufacturing process, with a large potential for cost and energy savings. Induction heating is the most energy efficient industrial heating technology for many applications, but so far technical limitations has delayed large scale introduction. The difficulties relate to heating of large flat and curved surfaces, and, perhaps most impo
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
We present a novel method for monitoring isothermal lipid hydration using a sorption microcalorimeter. A measuring cell of the double-twin calorimeter consists of two vessels connected by a stainless steel tube. The upper vessel contains pure water, and the bottom vessel is loaded with the lipid sample. This calorimeter allows for simultaneous measurement of the partial molar enthalpy and the chem
Current optical space telescopes rely upon silicon charge-coupled devices (CCDs) to detect and image the incoming photons. The performance of a CCD detector depends on its ability to transfer electrons through the silicon efficiently, so that the signal from every pixel may be read out through a single amplifier. This process of electron transfer is highly susceptible to the effects of solar proto
Diffusion kurtosis imaging (DKI) is an emerging technique with the potential to quantify properties of tissue microstructure that may not be observable using diffusion tensor imaging (DTI). In order to help design DKI studies and improve interpretation of DKI results, we employed statistical power analysis to characterize three aspects of variability in four DKI parameters; the mean diffusivity, f
Popular Abstract in Swedish Förbränningsmotor är i dagens värld den mest använda kraftkällan för fordon. Förbränningsmotorn har kontinuerligt utvecklats och förbättrats sedan Nicolaus August Ottos och Rudolf Diesels dagar, och kommer att fortsätta att utvecklas långt in i framtiden. Ingen konkurrerande teknik har ännu på allvar utmanat förbränningsmotorns ställning. Det finns en lång rad tänkbara The prime mover in the world today is the Internal Combustion (IC) engine. The development and improvement of the internal combustion engines since Nicolaus August Otto and Rudolf Diesel has continued until today and will continue long into the future. No major competitor to the IC engine has yet emerged. There is a long list of potential competitors but they still have to prove their superiority
In recent years global problems such as climatic change, acid rain, and water pollution in surface and subsurface environments dominate discussions of world environmental problems. In this paper, the roles of hydrologic processes and hydrogeochemical processes are investigated through development, modification, and application of mathematical models for addressing point and non-point source water
Popular Abstract in Swedish 10.SWEDISH SUMMARY(Populärvetenskaplig sammanfattning) Proteiner är viktiga byggstenar i cellen och är uppbyggda av kroppens tjugo olika aminosyror. Varje protein har en unik egenskap och spelar en viktig roll för cellens funktion. Vissa proteiner löser sig i vatten (hydrofila) medan andra är olösliga (hydrofoba). Membranproteiner är hydrofoba proteiner som är inbäddadeMembrane proteins are crucial components of the cell and are involved in many biological processes. Recombinant overexpression systems together with different purification methods are necessary to obtain large amounts of purified receptor for biophysical and functional studies. More knowledge about membrane proteins, and especially G-protein coupled receptors, would facilitate the development of i
This thesis introduces and summarizes four papers dealing with the study of double and multiple stars using space astrometry. The introduction gives a brief review of the role of binary observations in various fields of astronomy --- star formation, stellar masses and the mass-luminosity relation, initial mass function, detection of sub-stellar mass companions. The astrometric techniques are also
The Swedish consumer magazine Råd & Rön (”Advice and Results”) has been available to Swedish consumers since 1958. For a major part of this time the Swedish state, represented by Konsumentverket (the Swedish Consumer Agency) and its predecessor, Konsumentinstitutet (the National Institute for Consumer Information), was the owner of the magazine. In 2006 Råd & Rön was sold to the independen
Recent advances in laser technology, with the development of extremely short-pulse, high-intensity lasers, have opened doors to new areas in atomic physics. By focusing light from an intense, short-pulse laser into a gas jet, the emission of high-order harmonics of the laser frequency has been studied. The aim of this work has been two-fold: to better understand the underlying physics of the harmo
MicroRNAs (miRNAs) are post-transcriptional gene regulators involved in a wide range of biological processes including tumorigenesis. Deregulation of miRNA pathways has been associated with cancer but the contribution of their genetic variability to this disorder is poorly known. We analyzed the genetic association of gastric cancer (GC) and its anatomical and histological subtypes, with 133 singl
Popular Abstract in Swedish Utvecklingen av laserpulser med extremt hög intensitet har försett forskare med ett verktyg som gör det möjligt att studera vad som händer då dessa pulser växelverkar med olika slags materia. Då växelverkan sker med en gas kan till exempel ultrakorta pulser från ultraviolett till röntgenområdet genereras som övertoner till laserpulsen. Dessa övertoner kan göras kortare The availability of short-pulse, high-intensity lasers has opened doors to new areas in atomic and plasma physics. The short pulses (a few femtoseconds), that are available today, enable unprecedented temporal measurements, while the high peak power accessible (several terawatts) allows physicists to study the interaction between light and relativistic plasmas. The aim of this work was twofold: i)
PURPOSE: The formation and spreading of market-, management- and individual-rights discourses into society, as well as the movement of consumerism, have paved the way for a transformation of the linguistic usage. The transformation suggests that the view of the care seeker has shifted from a waiting patient, via a consumer to a customer creating value. Another example of the process is that the fo
Popular Abstract in Swedish Många av dagens biotekniska processer syftar till att framställa protein. Det är proteinets användningsområde som är avgörande för vilka renhetskrav som ställs på produkten. I vissa fall måste proteinet vara helt fritt från föroreningar för att inte åstadkomma oönskade effekter. Vaccinframställning är ett exempel på en sådan tillämpning. För andra ändamål, t ex vid framTwo polymers, alginate and Eudragit S-100 were used as reversibly soluble-insoluble ligand carriers for the selective isolation of enzymes and lectins respectively. These two polymers have the inherent property of being precipitated under well defined conditions. Alginate was made insoluble by the addition of Ca2+ ions, and Eudragit S-100 by a pH shift. The polymers were modified with affinity lig
Popular Abstract in Swedish Stärkelsemikrosfärer undersökta i denna avhandling är avsedda för kontrollerad tillförsel av läkemedel som utförs i form av depåpreparat eller slow release-former. Stärkelsemikrosfär är en beredningsform anpassad för inkapsling av protein i terapeutiskt syfte. För att uppnå en kontrollerad frisättning kan stärkelsemikrosfärer täckas av poly (DL-lactide-co-glycolide) (PStarch microsphere is a dosage form suitable for the encapsulation of protein drugs. The starch microspheres investigated in this thesis are intended for release of the drug in a pre-designed way, or in controlled manner. For this purpose the starch microspheres can be coated by poly(DL-lactide-co-glycolide) (PLG) film, which is a release controlling. The term microsphere quality is complicated an
Popular Abstract in Swedish Ett flertal produkter som framställs inom den kemiska och biotekniska industrin produceras i stora turbinomrörda tankar. Kvaliteten av produkten och utbytet av processen påverkas av blandningsförhållandena i dessa tankar. Blandningsförhållandena i processen påverkas av vätskans hastighet och dess intensitet. I olika regioner av reaktorn, impeller regionen och bulk regiTurbine-agitated tanks are used in chemical and biochemical applications to increase mixing which, in turn, affects the yield, productivity and product quality. The purpose of this work was to study the hydrodynamic influence on the scale-up of turbine-agitated tanks, commonly used in fermentation. Local turbulent flow parameters, the turbulent kinetic energy and the local energy dissipation rate,
Popular Abstract in Swedish Tjugo patienter som deltog i psykiatrisk öppenvård baserad på arbetsterapi undersöktes beträffande behandlingsresultat, uppfattningen om vårdklimatet och upplevelsen av behandlingsrelationen med arbetsterapeuten. Psykiatriska symtom, global mental hälsa, livskvalitet och fungerandet i dagligt liv studerades vid inskrivning i behandlingen, vid utskrivning, samt vid en etThe outcomes of 20 patients participating in occupational group therapy at a psychiatric outpatient unit were explored and related to perceptions of the ward atmosphere and the treatment process. The outcome variables - psychiatric symptoms, global mental health, quality of life, and occupational functioning - were measured at admission, at discharge, and 1 year after discharge. The ward atmospher
