Filtyp
Jet quenching is the process of color-charged partons losing energy via interactions with quark-gluon plasma droplets created in heavy-ion collisions. The collective expansion of such droplets is well described by viscous hydrodynamics. Similar evidence of collectivity is consistently observed in smaller collision systems, including p p and p + Pb collisions. In contrast, while jet quenching is ob
Purpose of Review: At elevated levels, the essential element manganese (Mn) is neurotoxic and increasing evidence indicates that environmental Mn exposure early in life negatively affects neurodevelopment. In this review, we describe how underlying genetics may confer susceptibility to elevated Mn concentrations and how the epigenetic effects of Mn may explain the association between Mn exposure e
The discovery of genetic loci associated with complex diseases has outpaced the elucidation of mechanisms of disease pathogenesis. Here we conducted a genome-wide association study (GWAS) for coronary artery disease (CAD) comprising 181,522 cases among 1,165,690 participants of predominantly European ancestry. We detected 241 associations, including 30 new loci. Cross-ancestry meta-analysis with a
Resin adsorption is an effective technology for the fermentable sugar slurry detoxification in lignocellulosic biorefinery, but with the great limitation of the loss of resin capacity from inhibitor contamination and the extensive use of acid and base solutions for their regeneration. In this study, we developed a green and practical method with ultrasound assisting the depletion of poisoned resin
Visual ecology, the study of how animals acquire and respond to visual information in nature, has grown rapidly over the past few decades. Research in this field has transformed our understanding of fundamental processes, such as the neurobiological basis of behavior and the diversification of species through sensory drive. The recent growth in the field has been accompanied by leaps in our unders
One way of controlling global warming is to substitute fuel driven cars with electric cars. Electric vehicles need to be charged. For maximal efficiency the charging times should be as short as possible. In the US charging stations are classified as Level 1 charging 5–10 miles/h, Level 2 25 miles/h and Fast DCFC stations 150–1000 miles/h. We asked participants to select one of two upgrades of char
Most types of materials and components use heating during the manufacturing process, with a large potential for cost and energy savings. Induction heating is the most energy efficient industrial heating technology for many applications, but so far technical limitations has delayed large scale introduction. The difficulties relate to heating of large flat and curved surfaces, and, perhaps most impo
In the interpretation of treaties, according to Article 31 of the 1969 Vienna Convention, interpreters shall pay primary regard to conventional language and to "relevant rules of international law applicable in the relations between the parties". Applying this provision, it is obvious that interpreters will sometimes face questions of an inter-temporal nature. What law or what language should be b
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
Diabetic muscle atrophy is an inflammation-related complication of type-2 diabetes mellitus (T2DM). Even though regular exercise prevents further deterioration of atrophic status, there is no effective mediator available for treatment and the underlying cellular mechanisms are less explored. In this study, we investigated the therapeutic potential of MCC950, a specific, small-molecule inhibitor of
Assessment of psychological constructs, such as the Big Five personality traits, has predominantly relied on standardized rating scales. While these scales have advantages, we propose that descriptive word-based responses analyzed with natural language processing (NLP) offer a promising alternative for assessing personality traits. We asked participants (N = 663) to describe either their own perso
Title: Resource Allocation in an Assembly System: From Manual Planning to Automated Decision Support. Authors: Malik Jusopov & Kasper Palm. Supervisors: Dr. Sandeep Jagtap, Division of Engineering Logistics, Faculty of Engineering, Lund University Johannes de la Cour, Internal Logistics Manager, Haldex Contribution: This thesis has been a complete collaboration between the two authors. Ea
Breast cancer is the most prevalent form of cancer among women in Sweden, with 9 000 diagnoses during 2023. While the five-year survival rate reaches 92.5% due to national screening programs, transitioning from 2D Digital Mammography to 3D Digital Breast Tomosynthesis (DBT) could further improve early detection. However, the high volumes of data increases the examination times, preventing it from
General syllabus for third-cycle studies in Sociology Page 1 of 9 Faculty Board GENERAL SYLLABUS SOCIOLOGY Reg. No. U 2025/221 Date 2024-04-24 General syllabus for third-cycle studies in Sociology The general syllabus for third-cycle studies in sociology was approved by the Board of the Faculty of Social Sciences on 24 April 2025, reg. no U 2025/221. Studies in accordance with the present general
https://www.sam.lu.se/en/internal/sites/sam.lu.se.en.internal/files/2025-05/asp-sociology-20250424.pdf - 2026-07-17
Sida 1 av 4 Fakultetsstyrelsen PROTOKOLL Datum 2025-11-05 Fakultetsstyrelsens protokoll Närvarande Ledamöter Per Persson, professor, dekan, ordförande Andreas Persson, universitetslektor Peter Samuelsson, professor Philipp Birken, professor Marie Dacke, professor Susanna Horsefield, professor Carina Rasmussen, forskningsingenjör Camilla Christensson, allmänrepresentant Lars-Johan Lyttkens Lindén,
LÖNEAVTAL för tjänstemän Avtal tecknat 2023 Giltighetstid: 2023-05-01–2025-04-30 Akademikerförbunden 1 Innehållsförteckning Löner Unionen ............................................................................... 3 Lokalt löneavtal – Unionen .......................................................... 11 Förhandlingsordning vid lönerevision – Unionen ....................... 17 Löner och förhand
Short communications and comments Influence of brood size on moult in female Willow Warblers Staffan Bensch, Lars Gezelius, Mats Grahn,* Dennis Hasselqvist, Ake Lindstrom and Ulf Ottosson, Dept of Animal Ecology, Univ. of Lund, Ecology Building, S-223 62 Lund, Sweden Like other tropical passerine migrants adult Willow Warblers Phylloscopus trochilus undergo a fast (ca. 40 d) moult of wing and tail
https://www.luvre.lu.se/sites/luvre.lu.se/files/luvre-067benschmflrugglosan.pdf - 2026-07-17
Microsoft Word - Lund-University-Information-sheet-2018-2019.docx INFORMATION SHEET 2018/2019 University-wide exchange agreements Contact Information Official website www.lunduniversity.lu.se Website for exchange students www.lunduniversity.lu.se/exchange-studies Postal address Lund University, External Relations, P.O. Box 117, SE-221 00 Lund, Swede
https://www.medarbetarwebben.lu.se/sites/medarbetarwebben.lu.se/files/lund-university-information-sheet-2018-2019.pdf - 2026-07-17
