Sökresultat

Mervärdesskatten är ett av de mest harmoniserade områdena inom EU-rätten. En central del av mervärdesskattesystemet är rätten till avdrag för ingående mervärdesskatt. Många företag bedriver blandad verksamhet som innebär att en del verksamheten är mervärdesskattepliktig, medan en annan del inte är det. Fastighetsägare och bostadsrättsföreningar kan bedriva frivilligt beskattad uthyrning av lokalerValue Added Tax (VAT) is one of the most harmonized areas of EU law. A central element of the VAT system is the right to deduct input VAT. Mixed economic businesses include both VAT liable and VAT exempt activities. Landlords can have voluntary taxation of rental properties alongside permanent residences which are exempt from VAT. In such businesses, costs are often shared between the different ac

Denna uppsats behandlar EU:s nya regler som förändrar kravet på prospekt - ett detaljerat informationsdokument som företag måste publicera när de erbju-der aktier till allmänheten eller noterar dem på en marknadsplats. Prospektet skyddar investerare genom att ge klar information om företaget, aktierna och riskerna, så att de kan fatta välgrundade beslut. Uppsatsen fokuserar på "tröskelvärdet&This essay discusses how the EU's new regulations change the requirement for prospectus - a detailed information document that companies must publish when offering shares to the public or listing them on a marketplace. The prospectus protects investors by providing clear information about the company, the shares, and the risks, enabling them to make well-informed investments. The essay focuses

With the current climate crisis, it is time to reframe our understanding of active mobility as a solution for short journeys only. When combined with public transport, almost any journey can be an active one. To compete with private automobile travel, public transport must combine the speed of motorised transport, the reliability of dedicated right-of-way services, and the flexibility of active tr

Several physicians have been nominated for the Nobel Prize in literature, but so far none of them have received it. Because physicians as women and men of letters have been a major topic of feuilletons, seminars and books for many years, questions arise to what extent medicine was a topic in the proposals for the Nobel Prize and in the Nobel jury evaluations: how were the nominees enacted (or not)

The invention relates to a method of 13C-MR detection using an imaging medium comprising hyperpolarised 13C-lactate and to an imaging medium containing hyperpolarised 13C1-lactate for use in said method.

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

Popular Abstract in English Nowadays, the majority of energy production comes from combustion which is universally linked to daily human activities. Public awakening of the environmental effects of combustion pollution evokes extensive research activities in improving combustion efficiency and reducing pollutant production. Development of combustion processes also includes the use of renewable bioThe work presented in the thesis concerns the developments of laser-based diagnostics and its application to the study of turbulent premixed combustion. The diagnostic developments, mainly concerned with planar laser-induced fluorescence (PLIF), are intended to provide instantaneous visualization of the key species originating from the combustion processes involved in the burning of hydrocarbons

Missions are being discussed widely within the European Union and beyond as a tool to steer policy, innovation, and research. Similar to other missions – to the moon, to cure cancer, and to eradicate smallpox – the missions-oriented approach seeks to set bold and radical goals to tackle our pressing environmental and social challenges. In this episode, we discuss the missions-oriented approach for

Popular Abstract in English “We are not free in this area.” This is what the iNduna, a traditional leader at KwaDapha, shared with me when we first met in August 2011. KwaDapha is a small rural community at Bhanga Nek, Kosi Bay, in northern KwaZulu-Natal/Maputaland – one of the most scenic areas on the South African coastline. Kosi Bay falls within the Coastal Forest Reserve section of the iSimaIn the past several decades under a growing influence of ecological modernisation, various assumed ‘win-win’ approaches to protected area conservation and poverty alleviation have been introduced all over the world, especially in resource-rich developing countries. Yet protected area conservation is an inherently political process, and the goals are often not achieved. There are concerns about com

Eliminating fast neutrons (lambda < 0.5 angstrom) by removing direct line of sight between the source and the target sample is a well established technique. This can be done with little loss of transmission for a straight neutron guide by horizontal curving. With an elliptic guide shape, however, curving the guide would result in a breakdown of the geometrical focusing mechanism inherent to the el

Popular Abstract in English Breast cancer is the most common cancer in women worldwide and the leading cause of cancer-related deaths. Although survival rates are low compared to other cancers, more than 500,000 women worldwide die of breast cancer every year. It is however not a single disease but rather a collection of different diseases with similar appearance but distinct molecular mechanisms.Background: Breast cancer is the most common female malignancy and the leading cause of cancer-related deaths worldwide. Targeted therapy against the main biomarkers estrogen receptor alpha (ER) and human epidermal growth factor receptor 2 (HER2/ERBB2) have greatly improved mortality rates, but ab initio or acquired therapy resistance is common. It is imperative to identify patients who will benef

Introduction: Assessing left ventricular (LV) systolic function in a rapid and reliable way can be challenging in the critically ill patient. The purpose of this study was to evaluate the feasibility and reliability of, as well as the association between, commonly used LV systolic parameters, by using serial transthoracic echocardiography (TTE). Methods: Fifty patients with shock and mechanical ve

Popular Abstract in Swedish From an economic viewpoint, derivatives and credit-extension instruments are the basic building blocks of all financial instruments. By structuring these building blocks in various combinations, it is possible to attain the economic substance of any conventional financial instrument – regular shares or bonds, as well as more complex financial instruments such as contingThe aim of this book is to examine the Swedish income tax treatment of derivatives, to ascertain the extent to which this treatment provides tax arbitrage opportunities, and to present possible solution that may prevent existing arbitrage opportunities. This study establishes that there are two types of financial instruments that constitute the greatest challenges regarding tax arbitrage opportuni

Popular Abstract in Swedish Arbetet avser studier av regnkarakteristik i tid och rum i Kuala Lumpur, Malaysia. I storskalig betraktelse studerades ett 550 km2 område för att bl.a. finna påverkan av monsuner. I skalan av ett avrinningsområde avsåg arbetet en studie av regnets dynamiska egenskaper och rumsliga korrelationsstrukturer. I en enpunktskala, för ett 23 km2 stort område framtogs sannolikheRainfall characteristics of Kuala Lumpur, Malaysia, are studied in space and time; on a large scale, 550 km2, and long term scale to find out the monsoon influence, and on urban basin scale, 23 km2, to determine dynamic properties of rainfalls and spatial correlations, and on a point scale to determine the probabilities of very high rain intensities. The importance of spatial and temporal variabi

https://www.keg.lu.se/sites/keg.lu.se/files/valkomstbrev_sgel40_ht17.pdf - 2026-05-03

1 1 List of publications - Charlotte Ling Total of 94 original publications, 16 invited review papers and 8 book chapters since 1999 H-index: 34; Number of citations ~6300 Original publications 1. Milana Kokosar, Anna Benrick, Alexander Perfilyev, Emma Nilsson, Thomas Källman, Claes Ohlsson, Charlotte Ling and Elisabet Stener-Victorin A Single Bout of Electroacupuncture Remodels Epigenetic and Tra

https://www.ludc.lu.se/sites/ludc.lu.se/files/charlotte_ling_publications_march_2018.pdf - 2026-05-03

Introduction: Environmental Change Social Vulnerability and Conflict Author: Mimi Tresman, mtresman@yahoo.com Supervisor: Turaj S. Faran, turaj.faran@ekh.lu.se Department of Economic History, P.O. Box 7083 S-220 07 Lund, Sweden Master’s Thesis, 22 November 2004 LUMES Lund University International Master's Programme in Environmental Science 1 mailto:mtresman@yahoo.com mailto:turaj.faran@ekh.lu.se T

https://www.lumes.lu.se/sites/lumes.lu.se/files/tresman_mimi.pdf - 2026-05-03

Kursguide - Course Syllabus • • • • • Fastställande Kursplanen är fastställd av Styrelsen för centrum för genusvetenskap 2013-05-15 och senast reviderad 2015-02-25. Den reviderade kursplanen gäller från och med 2015- 02-25, vårterminen 2015. Allmänna uppgifter Kursen utgör ämnesfördjupning i ämnet genusvetenskap på avancerad nivå. Kursen kan läsas som fristående kurs eller inom program på avancera

https://www.genus.lu.se/sites/genus.lu.se/files/gnvn03_1.pdf - 2026-05-03

Exploring the Dotterel Mountains: Improving the understanding of breeding habitat characteristics of an Arctic-breeding specialist bird Christian Hoefs1,2*, Tim van der Meer3, Peter Antkowiak4, Jonas Hagge5, Martin Green6 & Jannis Gottwald1 1Department of Geography, Philipps-University Marburg, Deutschhausstraße 12, 35037 Marburg, Germany 2Bioplan Marburg: Ecological Consultancy for Environmental

https://www.luvre.lu.se/sites/luvre.lu.se/files/2021-12/Luvre-168,%202021-Dotterels%20Hoefs.pdf - 2026-05-03