Sökresultat

https://www.intramed.lu.se/sara-westling - 2026-07-18

Sjukhusdesign och innovativ städning kan skydda patienter mot resistenta bakterier – Vetenskap och Hälsa Hoppa till innehåll Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Sjukhusdesign och innovativ städning kan skydda patienter mot resistenta bakterier 2017-09-08 ⚠️ Den här artikeln är mer än 5 år gammal. Ny

https://www.vetenskaphalsa.se/sjukhusdesign-och-innovativ-stadning-kan-skydda-patienter-mot-resistenta-bakterier/ - 2026-07-19

https://www.jur.lu.se/evelina-persson - 2026-07-18

The purpose of this report is to evaluate the safety of life during evacuation from the icebreaker Sankt Erik in Stockholm in the event of fire onboard. Sankt Erik was decommissioned in 1977 and operates since 1980 as a museum under the Swedish Maritime Museum in Stockholm, moored at Galärvarvet. Being a museum no major alterations to the structure are allowed. Furthermore, the majority of the mat

https://www.msf-malmo.lu.se/sites/msf-malmo.lu.se/files/seminarieschema-2016.pdf - 2026-07-19

https://www.biologyeducation.lu.se/sites/biologyeducation.lu.se/files/2022-05/L%C3%A4rarnasPlanering2022_2023.pdf - 2026-07-19

NYTT FRÅN LUNDS UNIVERSITET Mejlutskick på svenska och engelska som vänder sig till fakultetskommunikatörer vid Lunds universitet för vidarespridning i fakultets- och institutionskanaler – Nr 11 v 12 - 2021. CORONARELATERAT Lunchföreläsningar för studenter om utmaningar med hemmastudier Studenthälsan ordnar kurser och föreläsningar under våren med fokus på hemmastudier. Ämnen som tas upp är tips,

https://www.cec.lu.se/sites/cec.lu.se/files/2021-04/LU-gemensamt%20Mejlutskick%20Nr%2011-v12-2021.pdf - 2026-07-19

https://www.khm.lu.se/en/sites/khm.lu.se.en/files/floormap_layers_khm2.pdf - 2026-07-19

Registerutdrag 1 (2) SK V 46 21 17 sv 00 03 * Skatteverket Registerutdrag 205 30 MALMÖ 0771-567567 2024-03-27 Datum 202100-3211 LUNDS UNIVERSITET Box 117 221 00 LUND Organisationsnummer Registreringar avseende skatteform, moms- och arbetsgivarregistrering Skatteform Godkänd för F-skatt fr.o.m. 1993-01-01 Registrerad för moms Vid framtidsdatum, se sid 2 Fr.o.m. 1979-07-01 SE202100321101 Momsreg.nr/

https://www.ekonomiwebben.lu.se/sites/ekonomiwebben.lu.se/files/2024-03/Registreringsbevis-LU.pdf - 2026-07-19

Uppsatsen använder sig av en rättsanalytisk metod med ett barnrättsperspektiv för att undersöka hur barns rättigheter beaktats i förarbetena SOU 2021:68 och prop. 2022/23:53 om Skärpta straff för brott i kriminella nätverk gällande lagförslagen kring höjning av straffminimum av rånbrottet i 8 kap. 5 § BrB samt utvidgning av häktningspresumtionen i 24 kap. 1 § 2 st. RB. Detta för att synliggöra hurThis essay uses a legal analytical method with a children rights perspective to examine how children’s rights have been considered in the preparatory works SOU 2021:68 and prop. 2022/23:53, regarding that for more crimes, detention will be presumed and an increase of the minimum penalty for robbery. The examination aims to highlight how the legislator considers children’s rights in preparatory wor

Ethicisation refers to the tendency to frame issues in ethical terms and can be observed in different areas of society, particularly in relation to policy-making on emerging technologies. The turn to ethics implies increased use of ethics expertise, or at least an expectation that this is the case. Calling for experts on ethics when ethically complicated questions need to be handled helps us to up

The dynamic interaction between a non-viscid, compressible fluid and an elastic structure is studied. Finite element formulations, using the weighted residual method, are derived. Different primary variables in the fluid domain are used and different source functions are considered.When a potential field is used, the dynamic interaction between fluid and structure yields nonsymmetric matrices. In The dynamic interaction between non-viscid, compressible fluid and an elastic structure is studied. Finte element formulations, using the weighted residual method, are derived. Different primary variables in the fluid domain are used and different source functions are considered.When a potential field is used, the dynamic interaction between fluid and structure yields nonsymmetric matrices. I addi

Dredging operations in ports, rivers, and waterways are essential for maintaining navigable depths, but they result in large volumes of dredged sediments (DS) that are often unsuitable for immediate reuse due to their high moisture content, low strength, and contamination. Stabilization and solidification (S/S) techniques are widely employed to improve the geotechnical properties of DS, making theDredging operations in ports, rivers, and waterways are essential for maintaining navigable depths, but they result in large volumes of dredged sediments (DS) that are often unsuitable for immediate reuse due to their high moisture content, low strength, and contamination. Stabilization and solidification (S/S) techniques are widely employed to improve the geotechnical properties of DS, making the

Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti

BACKGROUND: Injuries were the most common cause of hospitalization in Sweden in 2017. There is a lack of knowledge about trauma recovery and its relation to health-related quality of life (HRQoL) after hospitalization due to minor trauma. This study aimed to prospectively evaluate recovery and HRQoL at discharge from hospital and 3 and 6 months after the trauma. METHODS: This is a secondary analys

The heat recovery system for ventilation is of major importance when low energy buildings are built. One alternative to the mechanical ventilation systems with heat recovery is to use a brine based run-around system that allows for heat recovery in for instance hybrid ventilated buildings. This type of heat recovery system has the potential to lower the need for electricity for the fans. Also, the

Att ersätta ändliga resurser med förnybara alternativ är en av mänsklighetens största utmaningar i modern tid. Utsläpp av växthusgaser orsakade av mänsklig civilisation behöver minska, och nya forskningsbaserade lösningar är nödvändiga för att åstadkomma långsiktigt hållbar tillväxt. I denna omställning kan biomassa från växter spela en viktig roll. Växtbiomassa består mestadels av socker som sitt