Filetype
Local unions | Sveriges akademikers centralorganisation Hoppa till huvudinnehåll About Saco Our issues Join a union Contact Employees About saco.se How we process your personal data Cookies and pixels Opinion & facts International activities Saco's EU Work Saco's EU Policy Union to Union Student fairs Saco Student Fair For exhibitors Sweden: A strong market for international recruitment Rates & st
https://www.saco.se/en/trustee/local-union-work/local-unions/ - 2026-05-04
Studievägledare Kontaktinformation E-post: marten [dot] wallette [at] nek [dot] lu [dot] se Telefon: +46 46 222 86 75Organisation Nationalekonomiska institutionen Rumsnummer: EC1:289 Hämtställe: 10 WebbplatsMårten Wallettes profil i Lunds universitets forskningsportal Publikationer Visar av publikationer. Sorterade efter år och sen titel. Filtrera efter typ AllaArtikel i tidskriftDoktorsavhandling
https://www.ehl.lu.se/marten-wallette - 2026-05-04
Postdoktor Kontaktinformation E-post: jack [dot] adler-mckean [at] mhm [dot] lu [dot] seOrganisation Musiker- och kyrkomusikerutbildningarnas kansli (Musikhögskolan) WebbplatsJack Adler-Mckeans profil i Lunds universitets forskningsportalAndra roller Postdoktor Musiker- och kyrkomusikerutbildningarnas kansli (Musikhögskolan)Jack Adler-McKean är en artist och forskare som fokuserar på tubafamiljen
https://www.mhm.lu.se/jack-adler-mckean - 2026-05-04
Semiconductor ecosystem to be strengthened Hoppa till huvudinnehåll Vi använder cookies och andra spårningsteknologier för att förbättra användarupplevelsen på vår webbplats, för att visa dig personligt innehåll och riktade annonser och för att analysera vår webbplatstrafik. Läs mer om cookies. Absolut nödvändiga cookies Dessa cookies är nödvändiga för att webbplatsen ska fungera och kan inte stän
https://www.lth.se/article/semiconductor-ecosystem-to-be-strengthened/ - 2026-05-04
Human Rights Forum Archives - Page 5 of 10 - The Raoul Wallenberg Institute of Human Rights and Humanitarian Law Skip to content Search for: Search Button Home About Us Who We Are Our History About Raoul Wallenberg Our Theory of Change Staff Opportunities Annual Reports Whistleblower Our work What we do Multi-Disciplinary Research Higher Education Strategic Advice and Analysis Outreach Evaluation
https://rwi.lu.se/category/human-rights-forum/page/5/ - 2026-05-05
Microsoft Word - Verksamhetsberättelse för Saco-S 2024-2025 1 Verksamhetsberättelse för Saco‐S‐rådets styrelse vid Umeå universitet för tiden 2024‐05‐23 ‐ 2025‐05‐22 Saco‐S‐rådets styrelse får härmed avge följande verksamhetsberättelse: Styrelsen har under året bestått av: Ordinarie ledamöter Förbund Håkan Lindkvist, ordförande SULF Johan Pålsson, vice ordförande
Postdoktor Kontaktinformation E-post: yohanna [dot] villalobos [at] mgeo [dot] lu [dot] seOrganisation Miljö- och geovetenskapliga institutionen (MGeo) Hämtställe: 16 WebbplatsYohanna Villalobos profil i Lunds universitets forskningsportalAndra roller Postdoc Institutionen för naturgeografi och ekosystemvetenskap Medlem i Strategiskt forskningsområde BECC: Biodiversity and Ecosystem services in a
https://www.nateko.lu.se/sv/yohanna-villalobos - 2026-05-04
Universitetslektor Kontaktinformation E-post: edith [dot] hammer [at] biol [dot] lu [dot] se Telefon: +46 46 222 45 36 Mobil: +46 73 244 19 68Organisation Funktionell ekologi Besöksadress: Kontaktvägen 10, Lund Rumsnummer: A224 Hämtställe: 50 WebbplatsEdith Hammers profil i Lunds universitets forskningsportalAndra roller Forskare Miljö- och geovetenskapliga institutionen (MGeo) Medlem i Strategisk
https://www.cec.lu.se/sv/edith-hammer - 2026-05-04
Calendar | Centre for Languages and Literature Calendar Link to rss Type of events All events Konferens Seminar Workshop Other Date from 6 May 6 May 2026 13:15 to 15:00 Seminar English language and linguistics research seminar: Beatrice Lanzini, University of Milano-Bicocca: Practice talk for Psycholinguistics in Flanders 2026 6 May 6 May 2026 13:15 to 15:00 Seminar Slutseminarium 7 May 7 May 2026
https://www.sol.lu.se/en/the-department/calendar/ - 2026-05-04
Civilingenjörsutbildning i teknisk nanovetenskap utbildningsplan Sida 1 av 6 Utbildningsplan Civilingenjörsutbildning i teknisk nanovetenskap - Programkod: TATNA - Omfattning: 300 högskolepoäng - Tillträdesnivå: Grundnivå - Beslutsfattare: Programledning N - Utbildningsplanens giltighet: 2025/2026 - Utbildningsplanen fastställd: 2025-02-12 1 Syfte och mål 1.1 Syfte Nanoteknologi är ett expansivt i
to be added
Contemporary practitioner and academic discourses of organizations and management have developed a tendency to discuss everyday organizational phenomena in overblown and remarkable ways. It is now commonplace to view organizations in terms of visions, missions, strategies, charisma, entrepreneurship, best practice and so on. A hyped-up language is becoming endemic to ordinary discussions of ordina
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
With advances in data acquisition and processing methods, spectral inversion of time domain (TD) induced polarization (IP) data is becoming more common. Geological interpretation of inverted spectral parameters, for instance Cole–Cole parameters, often relies on results from systematic laboratory measurements. These are most often carried out with frequency domain (FD) systems on sandstone samplesWith advances in data acquisition and processing methods, spectral inversion of time domain (TD) induced polarization (IP) data is becoming more common. Geological interpretation of inverted spectral parameters, for instance Cole–Cole parameters, often relies on results from systematic laboratory measurements. These are most often carried out with frequency domain (FD) systems on sandstone samples
In contemporary moral philosophy, the standard way of understanding the constituents of the human good is in terms of a fairly limited number of features that contribute to our happiness independently of how they are situated in our lives. Even when this approach is supplemented by Moorean ideas about organic wholes, it still cannot do justice to the deep importance of how things are situated and
The protonation status of key residues and bound ligands are often important for the function of a protein. Unfortunately, protons are not discerned in normal protein crystal structures, so their positions have to be determined by more indirect methods. We show that the recently developed quantum refinement method can be used to determine the position of protons in crystal structures. By replacing
As a group of stars having high luminosity and thus being able to be detected to great distances, massive M supergiants are extremely helpful to the study of the kinematics of the Milky Way. They are also partly responsible for the creation of post iron-group elements through the weak s-process of nucleosynthesis. As there are relatively few classified M supergiants, owing to their rapid pace of e
The structure tensor is a powerful tool describing the local intensity structure of an image or image sequence. In this paper we give a model for the noise distribution of the components of the tensor. In order to do so we have also investigated some properties of the gamma distribution. We show that, given an input image corrupted with Gaussian noise, the noise in the structure tensor can be mode
This paper deals with limitations on control system performance due to load disturbances, measurement noise, actuator saturation and system dynamics. Simple problems which capture the essence of the problem are formulated and solved. The results make it possible to quickly explore a design problem for preliminary assessment before attempting to do massive computations. They are also useful ingredi
