Filetype
Compensational voting refers to when voters cast a vote for a more extreme party than they prefer, in order to push policies closer to an ideal point. This article develops the idea of compensational voting in regard to pre-electoral coalition signals and polling trends. The argument is that a significant share of voters consider the relative strength of the parties in their preferred pre-electora
This paper argues that rules and norms are conceptually distinct: what is norm is not thereby rule, and vice versa. Versions of conflating the two are discussed and an argument for distinction given. Two objections to the argument are responded to. It is accepted that rules and norms are often intimately related. They are so causally, not conceptually: what norms we live by can make a difference t
When corporations are faced with accusations of crime, they usually find it necessary to justify their actions to the public, the media and their shareholders. Corporate self-defense, aimed at protecting a corporation’s image and legitimacy, belongs to a broader category of offenders’ denials and neutralizations. The objective of this article is to compile and discuss literature that is of value fWhen corporations are faced with accusations of crime, they usually find it necessary to justify their actions to the public, the media and their shareholders. Corporate self-defense, aimed at protecting a corporation’s image and legitimacy, belongs to a broader category of offenders’ denials and neutralizations. The objective of this article is to compile and discuss literature that is of value f
https://www.cors.lu.se/inscribing-belonging - 2026-04-21
Open Access journals are journals whose content is freely available to readers; publication costs are covered through a financial model other than subscription. More and more research fields are gaining good, open access alternatives for publishing as the number of OA journals increases. Find OA journalsThe Directory of Open Access Journals (DOAJ) is the largest database of quality controlled OA j
https://www.lub.lu.se/en/services-and-support/publishing-and-registering/open-access/oa-journals - 2026-04-21
Lunds universitet och GIS-centrum erbjuder en mångfald av utbildningar inom GIS och geomatik. Utbildningarna vänder sig till studenter, anställda vid Lunds universitet och externa uppdragsgivare.Utbildningarna varierar från några timmar till en universitetsexamen - allt efter behov. GIS-centrum kan även skräddarsy utbildningar utifrån särskilda önskemål.UniversitetskurserLänken nedan leder till ut
https://www.gis.lu.se/sv/gis-centrum/utbildning - 2026-04-21
Our digital collections are constantly growing. Though focusing on old, rare, and fragile documents, our ambition is also to create digital collections that reflect the diversity and richness of our physical collections, comprising manuscripts, maps, and printed books as well as photographs and images. Our ambitions are: To increase access – digitisation makes our collections available to everyone
https://www.ub.lu.se/en/find/digital-collections/about-digital-collections - 2026-04-21
Varför behövs fysikkunskaper i dagens samhälle? Hur kan skolfysiken ge eleverna relevant medborgarkunskap? Ska fysikundervisningen ta upp samhällsfrågor - eller ska det överlåtas till samhällskunskapen? Att arbeta med samhällsfrågor (socio-scientific issues på engelska) kan vara ett sätt att lyfta fram relevansen av kunskaper inom fysik och naturvetenskap i ett samhällsperspektiv. Samtidigt som de
https://www.nrcf.lu.se/lararresurser/att-arbeta-med-samhallsfragor - 2026-04-21
CMES is organising the Third Annual Swedish Middle East and North Africa Network (SWEMENA) Conference, Lund University, 22-23 August 2024. This interdisciplinary annual conference reflects SWEMENA’s main objective to bring together different communities of researchers, practitioners, and policy-makers across Sweden with an interest in the Middle East and North Africa region SWEMENA encourages the
https://www.cmes.lu.se/strategic-research-area-middle-east/swemena-annual-conference-2024 - 2026-04-21
Testosteronbrist hos barncancer-behandlade – Vetenskap och Hälsa Vetenskap och hälsa Populärvetenskapligt om medicinsk forskning i Skåne Teman Podd Tidskrift Prenumerera Om webbplatsen Kontakt Sök Sök Testosteronbrist hos barncancer-behandlade 2010-06-02 ⚠️ Den här artikeln är mer än 5 år gammal. Nya forskningsrön kan ha tillkommit. Nästan en fjärdedel av de män som behandlats för barncancer i sin
https://www.vetenskaphalsa.se/testosteronbrist-hos-barncancer-behandlade/ - 2026-04-21
The anations of Pt(H2O)42+ and PtX(H2O)3+ (to trans-PtX(H2O)2) by X− = Cl−, Br−, I− and SCN− and the anation of trans-PtX2(H2O)2) by X− = Cl−, Br− and I− have been studied at 25 °C and 1.00 M perchlorate medium using both stopped-flow and conventional spectrophotometry. For large excess of X−, PtX42− is formed according to the mechanism in Figure 1. The results indicate an entering ligand order of
Central to the sustainable production and consumption (SCP) agenda is the need for radical changes not only in the ways we produce but also in the ways we consume. The SCP agenda emerged within the understanding that it is not possible to reach the necessary reductions in environmental impact and resource consumption purely by technical solutions directed at improving the efficiency of production
BackgroundPatient education and dialogue are important when choosing a future treatment strategy for patients with chronic kidney disease. To support patients in their decision-making process, it is critical to provide information in a way that patients can understand. This study was conducted to understand how nephrologists view the goals of information sharing, the challenges involved, and the s
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
A major strand in social work’s history has been its paternalistic character, partly due to a philanthropic tradition, but also to the tendency to import an individualist expert model into social work practice. As a result, gaps have arisen between expert and experiential knowledge. In this article, so called ‘gap mending strategies’ developed by the international network PowerUs are discussed. Po
© In ter IK E A S y stem s B .V . 2 0 1 7 Human Resources Internship, IKEA Industry Hej, We are a diverse group of people working together, sharing the humanistic IKEA values. The values are the foundation of our work. By living them, we form the unique IKEA culture where team spirit and togetherness are key. In a constantly growing IKEA, every individual is taken care of, respected, acknowledged
https://www.psy.lu.se/sites/psy.lu.se/files/internship_ikea_human_resources_ht2019.pdf - 2026-04-22
Avfallshandbok: Del 7. Farligt avfall – smittförande, biologiskt och läkemedelsavfall Sida 1 av 14 Diarienummer: V 2024/2581 Handlingstyp: 2.3.2 Rutin Ämnesområde: Miljöledning Gäller för: Lunds universitet Datum: 2025-01-01 Version: 1.0 Framtaget av: Miljöfunktionen, LU Byggnad Godkänd av: Miljöchef Avfallshandbok: Del 7. Farligt avfall – smittförande, biologiskt och läkemedelsavfall Denna rutin
Utvecklingsenheten Postadress Campus Helsingborg Box 882, 251 08 Helsingborg Besöksadress Universitetsplatsen 2, 252 25 Helsingborg Telefon, 042-35 65 19, 042- 35 65 00 (växel) E-post carola.fors@ch.lu.se Webbadress www.ch.lu.se 1 (6) Minnesanteckningar från Campusgruppsmöte 10 december Närvarande: Jerker Jacobsson Utvecklingsenheten Julia Luttrup Utvecklingsenheten Magnus Adenskog Utvecklingsenhe
https://www.ch.lu.se/internt/sites/ch.lu.se.internt/files/2025-12/Campusgruppen%202025-12-05%20minnesant.pdf - 2026-04-22
