Filetype
This paper argues that rules and norms are conceptually distinct: what is norm is not thereby rule, and vice versa. Versions of conflating the two are discussed and an argument for distinction given. Two objections to the argument are responded to. It is accepted that rules and norms are often intimately related. They are so causally, not conceptually: what norms we live by can make a difference t
Background: As much as 40–50% of children are expected to sustain fractures during growth. A childhood fracture is alsoassociated with high risk of fractures in adult life. Previous research has shown that fracture incidence has not been stable andsome studies suggest that this has also continued during recent decades.Aims: The aim of this thesis was therefore to describe fracture epidemiology and
Open Access journals are journals whose content is freely available to readers; publication costs are covered through a financial model other than subscription. More and more research fields are gaining good, open access alternatives for publishing as the number of OA journals increases. Find OA journalsThe Directory of Open Access Journals (DOAJ) is the largest database of quality controlled OA j
https://www.lub.lu.se/en/services-and-support/publishing-and-registering/open-access/oa-journals - 2026-04-21
Our digital collections are constantly growing. Though focusing on old, rare, and fragile documents, our ambition is also to create digital collections that reflect the diversity and richness of our physical collections, comprising manuscripts, maps, and printed books as well as photographs and images. Our ambitions are: To increase access – digitisation makes our collections available to everyone
https://www.ub.lu.se/en/find/digital-collections/about-digital-collections - 2026-04-21
16–17 April 2026 Plenary on Thursday 16 AprilMichael BertramWildlife behaviour in a polluted world: tracking changes across ecological scalesAnimal behaviour is remarkably sensitive to disruption by chemical pollution, with widespread implications for ecological and evolutionary processes in contaminated wildlife populations. However, conventional approaches applied to study the impacts of chemica
The anations of Pt(H2O)42+ and PtX(H2O)3+ (to trans-PtX(H2O)2) by X− = Cl−, Br−, I− and SCN− and the anation of trans-PtX2(H2O)2) by X− = Cl−, Br− and I− have been studied at 25 °C and 1.00 M perchlorate medium using both stopped-flow and conventional spectrophotometry. For large excess of X−, PtX42− is formed according to the mechanism in Figure 1. The results indicate an entering ligand order of
Background: Breathlessness is a cardinal symptom of chronic obstructive pulmonary disease (COPD). Long-term oxygen therapy (LTOT) is given to improve survival time in people with COPD and severe chronic hypoxaemia at rest. The efficacy of oxygen therapy for breathlessness and health-related quality of life (HRQOL) in people with COPD and mild or no hypoxaemia who do not meet the criteria for LTOT
Popular Abstract in Swedish Den här avhandlingen fokuserar på socialsekreterares utredningsarbete av barn och unga inom socialtjänsten. Syftet har varit att beskriva och analysera tvångsvårdsprocessen ur socialsekreterares perspektiv, samt förstå och förklara hur detta påverkar barnavårdspraktiken. Det empiriska materialet består av barnavårdsakter och fokusgruppsintervjuer med socialsekreterare. This dissertation focuses on assessments concerning children and young persons in the Social Services. The aim has been to describe and analyse the compulsory care process from a social worker perspective, and to understand and explain how this affects the practice of child welfare. I have used case files from the Social Services and focus group interviews with social workers as empirical data. Th
Severe obesity during childhood is associated with cognitive deficits. Studies in adults have suggested improvements in executive functioning and memory after bariatric surgery. Our aim was to explore changes in cognitive function in adolescents over two years after bariatric surgery or intensive non-surgical treatment. Methods: The Adolescent Morbid Obesity Surgery 2 (AMOS2) is a multicentre, ope
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
Verksamhetsplan och resursfördelning 2024 Verksamhetsplan och resursfördelning 2024 LUNDS UNIVERSITET | NATURVETENSKAPLIGA FAKULTETEN 2 Förord Då frågade Pilatus: Vad är sanning?" och eko svarade - profeten teg. Med gåtans lösning bakom slutna läppar till underjorden Nazarenen steg. Men gudskelov, att professorer finnas, för vilka sanningen är ganska klar! De äro legio, ty de äro månge, som skänkt
+ Extr a bilaga o m in novato n LUM lunds universitets magasin | nr 4 | 2011 Stort polisintresse för tydligare Dna-analyser Förtroendet för forskare minskar feMinina förebiLder 2 LUM nr 4 | 2011 rUM för rådsLag LUM nr 4 | 2011 3 För inte så länge sedan var tredje våningen i Juridiska fakultetens hus på Lilla Gråbrödersgatan fylld av kablar och hyllor med kretskort från golv till tak. Fönstren var
https://www.lu.se/sites/www.lu.se/files/lunds-universitets-magasin-4-2011.pdf - 2026-04-22
LUM Lunds universitets magasin | Nr 7 | 2007 biobröder Faller en så faller alla ESS värmer upp Lund? LUM nr 7 | 2007 Scenbyte LUM nr 7 | 2007 Äntligen har Teaterhögskolan i Mal- mö fått undervisningslokaler och teaterscen på samma ställe. Fast när Bryggeriteatern stod klar i Mazettikvarteret 004 fanns det inga tankar på att man också kunde flytta resten av skolan dit. Men en lycklig slump gjorde
https://www.lu.se/sites/www.lu.se/files/lunds-universitets-magasin-7-2007.pdf - 2026-04-22
© In ter IK E A S y stem s B .V . 2 0 1 7 Human Resources Internship, IKEA Industry Hej, We are a diverse group of people working together, sharing the humanistic IKEA values. The values are the foundation of our work. By living them, we form the unique IKEA culture where team spirit and togetherness are key. In a constantly growing IKEA, every individual is taken care of, respected, acknowledged
https://www.psy.lu.se/sites/psy.lu.se/files/internship_ikea_human_resources_ht2019.pdf - 2026-04-22
Universitetsbibliotekets årsberättelse 2025 1 Universitetsbibliotekets årsberättelse 2025 LUNDS UNIVERSITET 2 Innehåll Fjärilen har slagit ut sina vingar ................................................................................ 3 PUBLIK VERKSAMHET I INSPIRERANDE MILJÖ ...................................................... 4 Vidareutveckla attraktiva och inspirerande studiemiljöer i en histo
https://www.ub.lu.se/sites/ub.lu.se/files/2026-03/arsberattelse-2025.pdf - 2026-04-22
Lund University International Student Prospectus 2024/25 Lund University INTERNATIONAL STUDENT PROSPECTUS 2024/25 Student Prospectus 2024/25 Lund University – a brief introduction ........................................................................ 3 World-leading research and innovation ..................................................................... 5 Lund campus .......................
Software | Student website LTH Skip to main content This site uses cookies to enhance the user experience. By continuing to use the site you agree that cookies are used according to our Cookie Policy (on the website of LTH) . Essential cookies These cookies are necessary for the website to function and cannot be turned off in our systems. These cookies do not store any personally identifiable info
https://www.student.lth.se/english/support-and-services/it-support-and-services/software/ - 2026-04-20
Lägg till titel Sida 1 av 4 Programråd för Ämneslärarutbildningen PROTOKOLL Datum 2025-11-27 STYR 2025/2966 Programrådets protokoll Ledamöter Närvarande Helena Berglund, bitr. utbildningschef, ordförande Sinikka Neuhaus, utbildningschef ÄLU Sara Håkansson, prodekan, grundutbildningen HT Björn Baderstam, samhällskunskap David Gudmundsson, religionskunskap Lukasz Michalak, fysik Paul Strand, svenska
https://www.uvet.lu.se/fileadmin/user_upload/uvet/lararutbildning/pdf/Protokoll/2025_a/Protokoll_PR_27_nov.pdf - 2026-04-20
2003_HT LP1 LTH000 CEQ-kursutvärdering ver 5.1 (2003-11-10) Arbetsrapport CEQ, LTH000 Basfakta Kurs Alla CEQ-behandlade kurser Kurskod LTH000 Läsår 2003_HT Kursen slutade i läsperiod LP1 Program Alla MÄN (civ.ing + branding.) Antal enkätsvar 2228 Antal män som svarat 2199 Antal kvinnor som svarat 0 Närvaro vid undervisningen Andel av undervisningen Antal Andel 0 % 38 2 % 20 % 91 4 % 40 % 133 6 % 6
https://www.ceq.lth.se/specialrapporter/lp_obligatoriska/rapporter/LTH000_2003_HT_LP1_man_arbetsrapport.html - 2026-04-20
