Search results
Filter
Filetype
Your search for "*" yielded 533538 hits
Betydelsen av etnicitet: gestaltningar av ’de andra’ i samtal om otrygghet, kriminalitet och utsatthet för brott
Detta projekt uppmärksammar brottsoffer och etnicitetsfrågor. I fokus står mellanmänskliga tolkningar av etnicitetens betydelse. Syftet är att analysera etnicitetstillskrivningar hos ungdomar som blivit utsatta för rån eller misshandel av andra ungdomar ”med annan etnicitet”. Med samtalsintervjun som metod studeras hur etnicitet omtalas och behandlas. Innebörden av begreppet är inte entydig, det i
The annual mean lowest temperature reconstruction based on Pinus Bungeanas (Pinus bungeana Zucc) ring width in the Yulin Region, Shandong, China since AD 1616
Scaling Down Multi-Echelon Inventory Problems
A SVD Based Controller Reduction Method
Nucleic Acids: Innovative Methods for Recovery, Clarification and Purification
Popular Abstract in English ...GTAAAAATTAAGCACAGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGAT TATGCCTGGCACCATTAAAGAAAATATCTTTGGTGTTTCCTATGATGAATATAGATACA GAAGCGTCATCAAAGCATGCCAACTAGAAGAG1.... The string of these block letters (A, T, C and G) is a tiny part of the human DNA sequence, which is more than 3 billion letters long. The combination of these block letters carries genetic information, similar to howThe importance of nucleic acids in pure form for preparative and analytical perspectives, have increased constantly, demanding the development of new and more efficient methods for their recovery and isolation. This thesis describes a series of different innovative methods for recovery and purification of these biomolecules. In a general overview of a downstream processing, there are several criti
Optimal Conditions for Critical Thinking : Between Relativism and Absolutism
2012; underhållning eller ej?
Intentional Partnerships – Creating New Partnerships
Syllabification in Southern Sámi
Abstract is not available
The “Renewable Revolution” and the CAP – Reforming the EU:s agricultural policy?
Homogenization of woven materials
The effective electric and magnetic material properties of a complex (twocomponent) mixture are addressed. The mixture is periodic in two directions and has a finite thickness in the third direction. Specifically,the explicit problem of finding the effective electric parameters for slab that has been reinforced by a layer (or several layers) of glass fiber is investigated. The homogenization probl
Backward electroproduction of π0 mesons on protons in the region of nucleon resonances at four momentum squared Q2 = 1.0 GeV2
Discovering Homo Administratus – coordinators / caseworkers in juvenile care
Ways of Seeing, Conceptualisation and Conceptual Change: Theoretical and methodological considerations
Publishing in Feminist Journals: What (not) To Do
The mediating document in ethnographic interviews: Capturing value creating processes in tourism
Feminism i Sverige – funderingar kring feminism, heteronormativitet och etnocentrism i Sverige
A Numerical Method for Design of PI Controllers
This paper presents an efficient numerical method to design PI controllers. The design is based on optimization of the load disturbance rejection, with constraints on the sensitivity and weighting of the set point response. Thus, the formulation of the design problem captures many aspects of industrial control problems. It leads to a nonconvex optimization problem. Efficient ways to solve the prob
Modes of propagation of electromagnetic pulses in open dispersive circular waveguides
Modes of propagation of electromagnetic pulses in open circular waveguides are investigated systematically. Core and cladding both consist of simple (linear, homogeneous, isotropic), dispersive materials modeled by temporal convolution with physically sound susceptibility kernels. Under these circumstances, pulses cannot propagate along the guide unless the sum of the (first) initial derivatives of